I. Debate

Topic 6. Making a biological "he" into a social "she" (Human Genetics, p. 119).

Sex reassignment. A controversial topic of ethics. The question is, is it really okay? I don't think so. How can you just "change" someone's gender? It just doesn't work that way.

• Dangers of surgery. Any adjustments to your body can be hazardous. Why would you cosmetically change something if your body is physically healthy? Sure, if you ask a person how they feel right after they have surgery, they'll say they feel and look great. The reason is because they don't know what health factors or symptoms could occur in the future. Sex reassignment is only a recent trend. It hasn't been around for decades and decades for people to know EXACTLY what's going to happen. Things could start happening. Issues and problems could arise.
  
• Socially acceptable? According to an article on Faqs.org, gender change "requires unique social, legal, and hormonal involvement." It takes time to transition. Also, when you get a sex change, you can't COMPLETELY change a girl into a guy or vice versa. You can't change a skinny girl into big, buff dude. Also, the voice. Despite changing the looks, you can't change the voice. It makes people socially UNacceptable, which could lead to emotional stress/alienation.
  
• Sex change doesn't exist. You can't REALLY "change" someone's gender. It's all cosmetics. All you're doing is changing someone's body from the outside.What happened to the saying, "What matters is in the inside"? Why do people have to go so far as to change their body? You don't HAVE to get surgery. Couldn't you just make yourself feel like the other sex without having surgery? One more question. Why go see a plastic surgeon when you could see a counselor or psychologist? Wouldn't you rather just accept who you are from the inside, than just change yourself from the outside?
  
• According to The Straight Dope, gender change may give people an advantage in sports, more specifically the Olympics. Statistically, men develop muscles faster than women, so therefore are more physically able than women. So men who have had sex reassignment could have an edge in sports, which would be unfair.

• People can change. People may look back a few years later and ask, "Why did I do this?" They might regret having a sex change. For example, a family member of mine got surgery on her breasts a couple of years ago. But now, she regrets having them done because of all the complications.
  

Reflection: I think that I did a good job presenting my stance on my topic in my debate on sex gender change. In the debate, I was against sex reassignment while my opponent, Tala Khatib, was for sex reassignment. She mentioned that many strong, pro points that had me biting my nails, like the GID syndrome. After our debate was over, we had many constructive and great comments that led to a class discussion all around. Thus, I thought the debate went well in the end and that it was pretty fun to do, although I was a bit nervous, but I think everyone was.

Sites/sources used:
http://www.faqs.org/health/topics/64/Sex-change-surgery.html

Human Genetics (pg. 119) Sex reassignment: Making a Biological "He" into a Social "She"
http://www.straightdope.com/columns/read/2782/switch-hitter

II. Design a Species

I, as Zoologist Nguyen, have traveled to the islands of Hipsyla and have just discovered a new species of bird. I've never seen anything like it! It's color, it's beak, it's wings even! I've been observing it for a few days now, surviving on nothing but some cans of Spam and Capri-Suns. It's worth it though, for this magnificent creature has yet to be shown to the world. It's not hostile, as far as I can see. I shall call this bird the Long-Nosed Tengu. The Tengu are ancient Japanese monster-spirits and are usually seen as "birds of prey", meaning that their physical features resembles that of a human and a bird. Anyways, on to my research and observation of this creature thus far:

• 2 Single Allele Traits: (Tail color) White tailed (TT)/Brown tailed (tt), (Eye color) Gold eyes (CC)/Copper eyes (cc)

• 1 Co-dominant Allele Trait: (Beak) White beaked (BB)/blue beaked(bb)/white & blue beaked (Bb)

• 1 Multiple Allele Trait: (Wing) Soaring wings (FF), High speed wings (GG), High-lift wings (FG), Elliptical wings (EE/EG/EF)

• 1 Sex-linked Trait: (spots) *X-linked gene* Female, round spots X^(r)X^(r)/Male, round spots X^(r)Y/Female, starry spots X^(s)X^(s)/ Male, starry spots X^(s)Y/ Female, starry & round spots X^(r)X^(s)

• 1 Incomplete Dominance Trait: (head color) Yellow (YY), Blue (bb), Green (Yb)

1. 2 Single Allele Traits:

























1 Co-dominant Allele Trait:













1 Multiple Allele Trait:













1 Sex-linked Trait:
(Not sure why this one is flipped on it's side...you'll just have to tilt your head to the right a bit)















1 Incomplete Dominance Trait:













2. Long Nosed Tengu #1












Long Nosed Tengu #2













3. Pedigree:













4. Dihybrid Cross:













5. Questions:
1. Create a punnet square crossing a Tengu homozygous dominant for tail color with a Tengy homozygous recessive for tail color. What are your results?

2. If you crossed a 2 Tengus, both heterozygous for eye color, what ratios are produced?

3. Can a male ever be a carrier for any trait? Why or why not?

6.

• The traits that are displayed are the white tail (TT), copper eyes (cc), white beaked (BB) *Forgot to put white straw over beak*, high speed wings (GG), female, starry & round spots X^(r)X^(s), and the Green head (Yb).

III. Creature DNA Fingerprinting

So someone doesn't believe the Easter Bunny is real. Well let that "someone" be smited by Zeus! I, as Forensics Detective Nguyen, have found some evidence, a bit of DNA, left at the scene of the crime.

ACGATCGATCGATACGACT|ATCGCTAGACGACTACGCATACGCAT|ATGCAGT
TGCTAGCTAGCTATGCTGA|TAGCGATCTGCTGATGCGTATGCGTA|TACGTCA